お問い合わせ

オープンデータを加工して共有しよう

テーブルデータの変換と公開をサポートするサイト

データセットの情報

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

評価指数

いいね!
0
Loading...



詳細情報を見たいファイルをプルダウンメニューから選択して下さい。
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Reproductive_organ
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:bladder label:ovary label:placenta label:prostate label:testis label:umbilical_cord label:uterus
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 25.12055 194.84211 75.92922 15.24749 7.75748 1101.0724 127.6999
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 1189.91564 1945.85448 283.58317 994.41671 28.91877 1273.66953 2293.95138
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 299.20626 4.63584 4.70371 8.28353 4.63584 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 578.01875 2685.62263 5452.30563 1508.95191 202.97486 1853.68141 1296.85014
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 276.90636 1233.71703 121.19528 421.01799 379.78898 582.92417 1350.69921
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 1185.9003 1194.52948 1071.66275 2749.39736 79.63258 1075.24473 1319.69656
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 265.5436 385.96114 46.14056 251.80297 22.85319 203.36206 240.89406
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 15.39857 19.36865 40.70168 12.43828 8.32211 8.60611 19.70432
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 3268.5267 1796.37235 6407.72953 1514.61865 52.24441 7114.82367 3559.61287
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 4780.86144 3430.57351 6385.24064 5010.51212 80.03506 2109.72826 12021.21266
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 243.97443 301.81704 300.9123 334.55807 68.71329 374.97556 316.19133
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 243.97443 301.81704 300.9123 334.55807 68.71329 374.97556 316.19133
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.7398 4.7398 4.84609 5.02893 4.95538 5.049 4.84609
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 212.18218 619.8011 572.66486 322.02812 38.8161 525.38732 755.52792
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 32.48724 4.63584 10.34955 7.0058 4.63744
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 60.98505 82.76852 77.79115 61.27186 65.71999 81.75634 57.8156
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 14.82342 38.99104 5.8786 9.40699 6.33286 202.96167 81.49683
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 235.43189 290.71633 45.44378 128.03598 50.34272 160.00878 164.8482
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 40.67858 15.64128 25.01332 25.9635 4.63584 40.64658 18.3758
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 40.67858 15.64128 25.01332 25.9635 4.63584 40.64658 18.3758
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 4.82193 4.73008 4.81824 4.82624 4.86893 4.82624 5.05546
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 6.79111 312.6372 16.80786 5.5632 8.38628 433.12747 4.89888
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 481.26878 141.30717 83.36443 291.9197 55.62467 131.53648 143.5015
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 447.64259 553.29736 234.98887 342.46294 46.82845 447.38684 383.51266
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 34.56026 214.94316 20.77798 49.91857 143.92235 38.07453 102.49893
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 1331.03318 3495.41351 130.62022 677.39645 279.75781 603.02644 1707.41516
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 19.42931 32.41237 5.46275 12.55094 4.71909 180.51774 112.95395
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 618.53224 609.20647 334.56157 908.95579 939.81627 342.65992 632.01778
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.79127 4.63584 4.63584 216.44679 5.51128 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 29.87326 14.10708 9901.05896 8.91161 13.67302 7.12167 22.2184
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.86452 9.0047 5.12962 4.79442 4.86452 5.4939 4.86452
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 8.53169 5.54312 14.58187 4.63584 5.11267 4.64479 4.63957
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 1378.21902 789.62517 2169.71224 1565.11438 68.3348 815.84385 813.7483
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.67168 4.63584 4.66243 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 10588.35307 4516.90528 1374.70729 3998.83852 388.39938 5389.50223 2278.222
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.67575 4.80325 4.63584 4.69025 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.67575 4.80325 4.63584 4.69025 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.67575 4.80325 4.63584 4.69025 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 7.07254 8.72103 8.7972 8.69902 8.53633 8.66401 7.04129
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.76622 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 324.11446 380.41247 339.40962 18.10067 5.01996 103.99385 188.43956
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 6656.10057 10984.13505 5953.49166 8865.67458 1406.48421 8479.7099 11155.5939
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 75.34085 79.62704 79.33631 10.61904 9.0284 59.94851 132.86678
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 75.34085 79.62704 79.33631 10.61904 9.0284 59.94851 132.86678
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 75.34085 79.62704 79.33631 10.61904 9.0284 59.94851 132.86678
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 122.79331 24.99507 27.0286 298.1727 17.53515 78.49705 35.64207
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 18280.11517 17430.66506 12487.1776 11614.86969 3242.39411 12110.69792 18885.31141
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 250.81957 270.73599 61.74297 73.72563 5.50877 176.60523 1051.86817
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 630.22009 9170.74024 6823.80945 1307.99866 16.5787 2774.0714 1357.89744
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 168.00988 4.64226 4.63584 53.02255 4.63584 701.28354 18.36736
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 82.11461 154.66359 344.02643 78.73765 101.24632 67.50906 154.03778
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 51.64857 293.77227 122.76477 5563.69833 26.85854 54.72867 49.61898
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 673.23675 84.98946 960.78921 367.00481 5.48713 1561.62881 111.27126
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 4.63584 4.77973 4.63584 4.63584 4.63584 130.71973 4.63584
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.89377 4.63584 7.09859 4.63584 4.73167
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 3582.03172 6232.11992 3702.87224 3909.14188 2598.30811 2621.43787 5418.72106
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 5.94068 5.75945 7.38377 9.06623 5.9391 5.96737 5.47964
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 70.20479 89.21057 80.91289 54.75937 15.20721 114.49765 36.51748
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 339.58416 377.17036 1194.89259 440.00198 237.22495 339.22448 366.08605
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 80.59532 5.88311 21.85507 10.67319 4.97742 92.81438 4.88452
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 4.63584 4.63584 4.63584 4.63584 4.6955 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 4.63584 4.63584 4.63584 4.63584 4.63584 5.09426 4.63584
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 169.71944 299.06506 234.05736 256.80295 628.27317 211.36896 223.89618
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 169.71944 299.06506 234.05736 256.80295 628.27317 211.36896 223.89618
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 7.31897 5.30684 6.14789 7.80951 6.33528 5.99214 5.02171
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 32.52456 86.83895 130.07673 45.47235 2443.85613 32.62085 24.72519
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 50.70104 89.62634 36.19598 24.31845 2036.29002 151.14234 106.90214
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 50.70104 89.62634 36.19598 24.31845 2036.29002 151.14234 106.90214
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 7361.44336 6563.14297 5937.84892 4905.38754 785.184 8622.5694 6970.98316
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.64697 4.64697 4.64697 4.64697 4.64697 4.84674 4.6414
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 128.48856 229.2638 235.70958 138.45065 212.40895 313.01791 170.54566
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.64973 4.63584 4.63584 5.01774 4.73617 4.65304
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 391.84089 1815.92368 139.57612 476.99659 487.59525 643.05287 1127.49035
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 8.83175 5.67113 14.56831 5.74946 5.1153 8.48227 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 10.44696 51.91814 6.59599 20.80494 8.88552 49.12809 121.69599
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 8.51152 6.52641 158.74089 8.69951 113.71532 7.95269 27.22684
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 66.05711 36.0408 10.46537 28.72692 1229.19883 71.0759 25.96722
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 6089.93939 6095.70966 4231.95653 4254.03859 1765.67939 4736.15948 6071.92282
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 35.18412 29.60645 2273.7624 46.98831 387.6245 100.3033 44.63566
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 12.23751 157.54164 12.6138 12.92452 453.38098 97.35453 105.61765
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 6.18501 6.07276 7.90597 26.42083 8.08216 8.83353 8.34654
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 4.95111 4.96377 6.69911 4.659 6.13681 7.44722 7.56155
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 17.34948 20.03759 22.66282 30.53041 28.83061 62.80949 20.46257
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 1056.6172 550.83286 4.82037 8956.20026 4.7304 8.21963 812.4821
* Row count is limited to 100.